Journal: Stem cell research

Article Title: Generation of 2 isogenic clones from a patient with Trisomy 21 and a GATA1 mutation

doi: 10.1016/j.scr.2023.103098

Figure Lengend Snippet: Characterization and validation

Article Snippet: Table 2: Antibodies used for immunocytochemistry/flow cytometry Antibody Dilution Company Cat # RRID Pluripotency Markers Mouse anti-Oct3/4 (C-10) 1:200 Santa Cruz #sc-5297 RRID:AB_628051 Rabbit anti-Nanog (D73G4) 1:400 Cell Signaling #4903S RRID:AB_10559205 Rabbit anti-Sox2 (D6D9) 1:300 Cell Signaling #3579S RRID:AB_2195767 AF488 anti-human SSEA-3 1:50 BioLegend #330306 RRID:AB_1279440 AF647 anti-human SSEA-4 1:400 BioLegend #330408 RRID:AB_1089200 AF488 anti-human Tra-1-60 1:100 BioLegend #330614 RRID:AB_2119064 AF647 anti-human Tra-1-81 1:50 BioLegend #330706 RRID:AB_1089242 Differentiation Markers PE mouse anti-human Sox17 1:25 BD #561591 RRID:AB_10717121 Mouse anti-human FoxA2 1:100 Santa Cruz #sc-101060 RRID:AB_1124660 Rabbit anti-FOXG1 1:300 Abcam #196868 RRID:AB_2892604 AF647 anti-human PAX6 1:20 BD #562249 RRID:AB_2644844 PE/Cyanine7 anti-human CD41 1:400 BioLegend #303718 RRID:AB_10899413 APC Mouse anti-human CD235 1:5000 BD #551336 RRID:AB_398499 Secondary Antibodies Goat anti-mouse IgG2a-AF647 1:400 Jackson Immunoresearch #115-605-206 RRID:AB_2338917 Goat anti-rabbit IgG-AF488 1:400 Jackson Immunoresearch #111-545-144 RRID: AB_2338052 Goat anti-mouse IgG2b-AF488 (flow cytometry) 1:400 Jackson Immunoresearch #115-545-207 RRID:AB_2338856 Goat anti-Mouse IgG (H+L)-AF488 (immunohistochemistry) 1:400 ThermoFisher #A-11029 RRID:AB_2534088 Primers Target Size of band Forward/Reverse primer (5′-3′) Sendai Screening (Taqman qRT-PCR) SEV 59 Mr04269880_mr SEV-KLF4 67 Mr04421256_mr SEV-KOS 80 Mr04421257_mr SEV-cMYC 89 Mr04269876_mr GAPDH 157 Hs02786624_g1 Targeted mutation analysis/sequencing GATA1 Exon 2 screen 387 bp AGATGCAGGAGGGAAAAGAG / CGGCACATCCATTTGAGAAG GATA1 sequencing AAGAGGAGCAGGTGAA Mycoplasma Detection 16S Ribosomal RNA 518 bp CGCCTGAGTAGTACGTTCGC / GCGGTGTGTACAAGACCCGA GAPDH (internal control) 150 bp GTGGACCTGACCTGCCGTCT / GGAGGAGTGGGTGTCGCTGT Open in a separate window Reagents details.

Techniques: Expressing, Flow Cytometry, Mutagenesis, Sequencing, Southern Blot, Virus, Reverse Transcription Polymerase Chain Reaction

Journal: Stem cell research

Article Title: Generation of 2 isogenic clones from a patient with Trisomy 21 and a GATA1 mutation

doi: 10.1016/j.scr.2023.103098

Figure Lengend Snippet: Reagents details

Article Snippet: Table 2: Antibodies used for immunocytochemistry/flow cytometry Antibody Dilution Company Cat # RRID Pluripotency Markers Mouse anti-Oct3/4 (C-10) 1:200 Santa Cruz #sc-5297 RRID:AB_628051 Rabbit anti-Nanog (D73G4) 1:400 Cell Signaling #4903S RRID:AB_10559205 Rabbit anti-Sox2 (D6D9) 1:300 Cell Signaling #3579S RRID:AB_2195767 AF488 anti-human SSEA-3 1:50 BioLegend #330306 RRID:AB_1279440 AF647 anti-human SSEA-4 1:400 BioLegend #330408 RRID:AB_1089200 AF488 anti-human Tra-1-60 1:100 BioLegend #330614 RRID:AB_2119064 AF647 anti-human Tra-1-81 1:50 BioLegend #330706 RRID:AB_1089242 Differentiation Markers PE mouse anti-human Sox17 1:25 BD #561591 RRID:AB_10717121 Mouse anti-human FoxA2 1:100 Santa Cruz #sc-101060 RRID:AB_1124660 Rabbit anti-FOXG1 1:300 Abcam #196868 RRID:AB_2892604 AF647 anti-human PAX6 1:20 BD #562249 RRID:AB_2644844 PE/Cyanine7 anti-human CD41 1:400 BioLegend #303718 RRID:AB_10899413 APC Mouse anti-human CD235 1:5000 BD #551336 RRID:AB_398499 Secondary Antibodies Goat anti-mouse IgG2a-AF647 1:400 Jackson Immunoresearch #115-605-206 RRID:AB_2338917 Goat anti-rabbit IgG-AF488 1:400 Jackson Immunoresearch #111-545-144 RRID: AB_2338052 Goat anti-mouse IgG2b-AF488 (flow cytometry) 1:400 Jackson Immunoresearch #115-545-207 RRID:AB_2338856 Goat anti-Mouse IgG (H+L)-AF488 (immunohistochemistry) 1:400 ThermoFisher #A-11029 RRID:AB_2534088 Primers Target Size of band Forward/Reverse primer (5′-3′) Sendai Screening (Taqman qRT-PCR) SEV 59 Mr04269880_mr SEV-KLF4 67 Mr04421256_mr SEV-KOS 80 Mr04421257_mr SEV-cMYC 89 Mr04269876_mr GAPDH 157 Hs02786624_g1 Targeted mutation analysis/sequencing GATA1 Exon 2 screen 387 bp AGATGCAGGAGGGAAAAGAG / CGGCACATCCATTTGAGAAG GATA1 sequencing AAGAGGAGCAGGTGAA Mycoplasma Detection 16S Ribosomal RNA 518 bp CGCCTGAGTAGTACGTTCGC / GCGGTGTGTACAAGACCCGA GAPDH (internal control) 150 bp GTGGACCTGACCTGCCGTCT / GGAGGAGTGGGTGTCGCTGT Open in a separate window Reagents details.

Techniques: Flow Cytometry, Immunohistochemistry, Mutagenesis, Sequencing, Control

Journal: Stem cell research

Article Title: Generation of 2 isogenic clones from a patient with Trisomy 21 and a GATA1 mutation

doi: 10.1016/j.scr.2023.103098

Figure Lengend Snippet:

Article Snippet: Table 2: Antibodies used for immunocytochemistry/flow cytometry Antibody Dilution Company Cat # RRID Pluripotency Markers Mouse anti-Oct3/4 (C-10) 1:200 Santa Cruz #sc-5297 RRID:AB_628051 Rabbit anti-Nanog (D73G4) 1:400 Cell Signaling #4903S RRID:AB_10559205 Rabbit anti-Sox2 (D6D9) 1:300 Cell Signaling #3579S RRID:AB_2195767 AF488 anti-human SSEA-3 1:50 BioLegend #330306 RRID:AB_1279440 AF647 anti-human SSEA-4 1:400 BioLegend #330408 RRID:AB_1089200 AF488 anti-human Tra-1-60 1:100 BioLegend #330614 RRID:AB_2119064 AF647 anti-human Tra-1-81 1:50 BioLegend #330706 RRID:AB_1089242 Differentiation Markers PE mouse anti-human Sox17 1:25 BD #561591 RRID:AB_10717121 Mouse anti-human FoxA2 1:100 Santa Cruz #sc-101060 RRID:AB_1124660 Rabbit anti-FOXG1 1:300 Abcam #196868 RRID:AB_2892604 AF647 anti-human PAX6 1:20 BD #562249 RRID:AB_2644844 PE/Cyanine7 anti-human CD41 1:400 BioLegend #303718 RRID:AB_10899413 APC Mouse anti-human CD235 1:5000 BD #551336 RRID:AB_398499 Secondary Antibodies Goat anti-mouse IgG2a-AF647 1:400 Jackson Immunoresearch #115-605-206 RRID:AB_2338917 Goat anti-rabbit IgG-AF488 1:400 Jackson Immunoresearch #111-545-144 RRID: AB_2338052 Goat anti-mouse IgG2b-AF488 (flow cytometry) 1:400 Jackson Immunoresearch #115-545-207 RRID:AB_2338856 Goat anti-Mouse IgG (H+L)-AF488 (immunohistochemistry) 1:400 ThermoFisher #A-11029 RRID:AB_2534088 Primers Target Size of band Forward/Reverse primer (5′-3′) Sendai Screening (Taqman qRT-PCR) SEV 59 Mr04269880_mr SEV-KLF4 67 Mr04421256_mr SEV-KOS 80 Mr04421257_mr SEV-cMYC 89 Mr04269876_mr GAPDH 157 Hs02786624_g1 Targeted mutation analysis/sequencing GATA1 Exon 2 screen 387 bp AGATGCAGGAGGGAAAAGAG / CGGCACATCCATTTGAGAAG GATA1 sequencing AAGAGGAGCAGGTGAA Mycoplasma Detection 16S Ribosomal RNA 518 bp CGCCTGAGTAGTACGTTCGC / GCGGTGTGTACAAGACCCGA GAPDH (internal control) 150 bp GTGGACCTGACCTGCCGTCT / GGAGGAGTGGGTGTCGCTGT Open in a separate window Reagents details.

Techniques: Virus, Modification, Mutagenesis

Journal: Polymers

Article Title: Photosensitive Poly- l -lysine/Heparin Interpolyelectrolyte Complexes for Delivery of Genetic Drugs

doi: 10.3390/polym12051077

Figure Lengend Snippet: CTB test: viability of HEK 293, BEAS 2B and NIH 3T3 cells incubated with different concentrations of cross-linked IPECs ([Lys–NH 3 + ]:[Hep–SO 3 − ]:[linker] = 1: 3:0.8).

Article Snippet: HEK-293 (human embryonic kidney), BEAS-2B (human bronchial epithelium), and NIH 3T3 (expressing GFP mouse fibroblast cells) cell lines were obtained from the German Collection of Microorganisms and Cell Culture (DSMZ, Braunschweig, Germany).

Techniques: Incubation

Journal: Polymers

Article Title: Photosensitive Poly- l -lysine/Heparin Interpolyelectrolyte Complexes for Delivery of Genetic Drugs

doi: 10.3390/polym12051077

Figure Lengend Snippet: RNA interference by anti-GFP small interfering RNA that was delivered by PLL/Hep IPECs ([Lys–NH 3 + ]:[siRNA–PO 4 − ]:[Hep–SO 3 − ]:[linker] = 1:1:4:0.8) in NIH-3T3 cell line. ( A ) Fluorescence microscopy images of NIH-3T3 cells after transfection with anti-GFP siRNA complexed by IPECs: a —intact cells; b —cells incubated with cross-linked anti-GFP-siRNA/IPECs; c —cells incubated with cross-linked anti-GFP-siRNA/IPECs and subjected to the treatment 5W UV 365 nm LED lamp for 30 min; d —cells incubated with anti-GFP-siRNA/PEI polyplex. ( B ) Flow cytometry detection of GFP fluorescence after co-incubation with anti-GFP siRNA containing complexes. Co-incubation time was 4 h. Mean (± SD), n = 5.

Article Snippet: HEK-293 (human embryonic kidney), BEAS-2B (human bronchial epithelium), and NIH 3T3 (expressing GFP mouse fibroblast cells) cell lines were obtained from the German Collection of Microorganisms and Cell Culture (DSMZ, Braunschweig, Germany).

Techniques: Small Interfering RNA, Fluorescence, Microscopy, Transfection, Incubation, Flow Cytometry

Journal: Experimental & molecular medicine

Article Title: NR4A1 suppresses breast cancer growth by repressing c-Fos-mediated lipid and redox dyshomeostasis.

doi: 10.1038/s12276-025-01430-3

Figure Lengend Snippet: Fig. 1 NR4A1 has a tumor-suppressive role in BC progression. a Analysis of the TCGA database shows that the NR4A1 mRNA level is decreased in all four types of BC samples compared with normal breast tissues. Unpaired Student’s t-test, ***P < 0.001. b Representative IHC staining of NR4A1 in cohort 1 TMA. Scale bars, 200 μm. c Quantitative IRS of NR4A1 as in b. Paired Student’s t-tests, ***P < 0.001. d Stratification of patients in cohort 2 with NR4A1 high expression (with IRS 6–12) or low expression (with IRS 0–4) at the protein level in TMA and its association with clinicopathological factors. Chi-square test. e IHC staining of NR4A1 in different AJCC TNM stages of BC. Scale bar, 200 μm. f, g Kaplan–Meier survival plots of patients with BC based on NR4A1 expression in TCGA cohort (f) and cohort 2 (g). OS, overall survival; HR, hazard ratio. h, i Log-rank tests. Univariate (h) and multivariate (i) analysis was performed in cohort 2. The bars correspond to 95% confidence interval (CI).

Article Snippet: The sections were then exposed to antigen and incubated with a specific primary antibody against NR4A1 (Proteintech, cat. no. 12235-1-AP; 1:100 dilution), c-Fos (Abcam, cat. no. ab208942; 1:200 dilution) or PRDX6 (Abcam, cat. no. ab133348; 1:100 dilution) at 4 °C overnight, followed by incubating with the corresponding secondary antibodies at 37 °C for 1 h. Representative images were taken using an Olympus light microscope.

Techniques: Immunohistochemistry, Expressing

Journal: Experimental & molecular medicine

Article Title: NR4A1 suppresses breast cancer growth by repressing c-Fos-mediated lipid and redox dyshomeostasis.

doi: 10.1038/s12276-025-01430-3

Figure Lengend Snippet: Fig. 2 NR4A1 deficiency promotes the proliferation of BC cells. a Immunoblotting analysis of NR4A1 knockout efficiency in MCF7 and T47D cells. b Cell proliferation assay was performed by CCK-8 assay in NR4A1-knockout and parental control MCF7 cells or T47D cells. c Colony formation assay was performed in NR4A1-knockout and parental control MCF7 cells or T47D cells. d, e Flow cytometry analysis (left) and statistical quantification of MFI (right) for Edu incorporation in NR4A1-knockout and parental control MCF7 cells (d) or T47D cells (e). MFI, mean fluorescence intensity. f–h NR4A1-knockout and parental control MCF7 cells were injected into the flank of female athymic nude mice (n = 6 per group). Tumor volumes were measured every 3 days. Tumor images (f), growth curves (g) and tumor weight (h) were obtained at day 21 after dissection. i Representative IHC staining of Ki67 and the statistical analysis of Ki67-positive percentages in tumors from f. Scale bar, 100 μm. Unpaired Student’s t-tests were used in c–e, h and i, and one-way ANOVA was used in b and g, *P < 0.05, **P < 0.01, ***P < 0.001.

Article Snippet: The sections were then exposed to antigen and incubated with a specific primary antibody against NR4A1 (Proteintech, cat. no. 12235-1-AP; 1:100 dilution), c-Fos (Abcam, cat. no. ab208942; 1:200 dilution) or PRDX6 (Abcam, cat. no. ab133348; 1:100 dilution) at 4 °C overnight, followed by incubating with the corresponding secondary antibodies at 37 °C for 1 h. Representative images were taken using an Olympus light microscope.

Techniques: Western Blot, Knock-Out, Proliferation Assay, CCK-8 Assay, Control, Colony Assay, Flow Cytometry, Injection, Dissection, Immunohistochemistry

Journal: Experimental & molecular medicine

Article Title: NR4A1 suppresses breast cancer growth by repressing c-Fos-mediated lipid and redox dyshomeostasis.

doi: 10.1038/s12276-025-01430-3

Figure Lengend Snippet: Fig. 3 NR4A1 deficiency regulates the lipid remodeling and phospholipid accumulation. a Rank-ordered depiction of fold changes for all analyzed genes quantified by RNA-seq with the significantly changed genes of 73 increased and 28 decreased (fold change >1.5 and FDR <0.05 difference) in NR4A1-knockout MCF7 cells compared with parental MCF7 cells. b GSEA analysis was conducted to identify the different gene profiles between NR4A1-knockout and parental MCF7 cells. c Single-sample GSEA analysis was performed to show the pathways closely correlated with NR4A1 expression in MCF7 cells. d Volcano plots of metabolites detected by UHPLC–QTOF–MS-based nontargeted metabolomics analysis in NR4A1-knockout and parental MCF7 cells. Red represents lipids and lipid-like metabolites (n = 61). e Heat map showed the classification of the significantly changed metabolites of 91 increased (fold change >1.5, FDR <0.05) in NR4A1-knockout MCF7 cells compared with parental MCF7 cells. f Enriched metabolic signaling pathways based on significantly changed metabolites (n = 199) cluster identified by pathway analysis (https://www.metaboanalyst.ca/). g, h Flow cytometry analysis (left) and statistical quantification of MFI (right) for BODIPY FL C16 to compare fatty acid uptake ability in NR4A1-knockout and parental control MCF7 or T47D cells. i, j RT-qPCR (i) and immunoblotting analysis (j) of CD36 in NR4A1-knockout and parental MCF7 or T47D cells. Unpaired Student’s t-tests were used in g–i, **P < 0.01, ***P < 0.001.

Article Snippet: The sections were then exposed to antigen and incubated with a specific primary antibody against NR4A1 (Proteintech, cat. no. 12235-1-AP; 1:100 dilution), c-Fos (Abcam, cat. no. ab208942; 1:200 dilution) or PRDX6 (Abcam, cat. no. ab133348; 1:100 dilution) at 4 °C overnight, followed by incubating with the corresponding secondary antibodies at 37 °C for 1 h. Representative images were taken using an Olympus light microscope.

Techniques: RNA Sequencing, Knock-Out, Expressing, Protein-Protein interactions, Flow Cytometry, Control, Quantitative RT-PCR, Western Blot

Journal: Experimental & molecular medicine

Article Title: NR4A1 suppresses breast cancer growth by repressing c-Fos-mediated lipid and redox dyshomeostasis.

doi: 10.1038/s12276-025-01430-3

Figure Lengend Snippet: Fig. 4 Suppression of NR4A1 exacerbates the redox balance disruption. a Seahorse extracellular flux analyzer measurement of ECAR metabolic profile in NR4A1-knockout and parental MCF7 or T47D cells. b Assessments of ATP production ability in NR4A1-knockout and parental MCF7 or T47D cells. c Seahorse extracellular flux analyzer measurement of OCR metabolic profile in NR4A1-knockout and parental MCF7 or T47D cells. d Intracellular GSH level in MCF7 and T47D cells with or without NR4A1 expression. e, f Flow cytometry analysis of intracellular ROS levels by DCFH-DA staining in NR4A1-knockout and parental MCF7 (e) or T47D (f) cells. ROS levels were quantified by MFI. g, h Lipid peroxidation measured by flow cytometry using the lipid peroxidation reagent in NR4A1-knockout and parental MCF7 (g) or T47D (h) cells. Lipid peroxidation was quantified by the ratio of red (PE)/green (FITC) fluorescence intensities, and the decreased ratio was correlated with higher lipid peroxidation. Unpaired Student’s t-tests were used in b and d–h, *P < 0.05, **P < 0.01, ***P < 0.001.

Article Snippet: The sections were then exposed to antigen and incubated with a specific primary antibody against NR4A1 (Proteintech, cat. no. 12235-1-AP; 1:100 dilution), c-Fos (Abcam, cat. no. ab208942; 1:200 dilution) or PRDX6 (Abcam, cat. no. ab133348; 1:100 dilution) at 4 °C overnight, followed by incubating with the corresponding secondary antibodies at 37 °C for 1 h. Representative images were taken using an Olympus light microscope.

Techniques: Disruption, Knock-Out, Expressing, Flow Cytometry, Staining, Cytometry

Journal: Experimental & molecular medicine

Article Title: NR4A1 suppresses breast cancer growth by repressing c-Fos-mediated lipid and redox dyshomeostasis.

doi: 10.1038/s12276-025-01430-3

Figure Lengend Snippet: Fig. 5 NR4A1–c-Fos interaction affects the transcriptional activity of c-Fos. a, b Prediction of transcription factors regulating the significantly upregulated genes in NR4A1-knockout MCF7 cells by using TFEA method in ChEA3 databases. Statistical results (a) and co- regulatory network for the functional interaction (b) for the top six predicted transcription factors. c Enrichment plot of the c-Fos dataset in GSEA analysis. Heat map of the top 20 genes upregulated in NR4A1-knockout cells from the c-Fos dataset. d Cell proliferation assay was performed by CCK-8 assay in ectopic c-Fos- or empty vector (EV)-overexpressed MCF7 cells or T47D cells. One-way ANOVA, ***P < 0.001. e, f Co-IP experiments to detect the interaction between NR4A1 and c-Fos. HEK293T cells were transfected for 24 h with plasmids encoding either Flag-NR4A1 or HA-c-Fos alone or in combination. Cell lysates were immunoprecipitated with Flag (e) or HA (f) antibodies. g c-Fos domain structure and deletion mutants used for Co-IP experiments. h Co-IP experiments were used to identify the interaction domain for c-Fos binding to NR4A1.

Article Snippet: The sections were then exposed to antigen and incubated with a specific primary antibody against NR4A1 (Proteintech, cat. no. 12235-1-AP; 1:100 dilution), c-Fos (Abcam, cat. no. ab208942; 1:200 dilution) or PRDX6 (Abcam, cat. no. ab133348; 1:100 dilution) at 4 °C overnight, followed by incubating with the corresponding secondary antibodies at 37 °C for 1 h. Representative images were taken using an Olympus light microscope.

Techniques: Activity Assay, Knock-Out, Functional Assay, Proliferation Assay, CCK-8 Assay, Plasmid Preparation, Co-Immunoprecipitation Assay, Transfection, Immunoprecipitation, Binding Assay

Journal: Experimental & molecular medicine

Article Title: NR4A1 suppresses breast cancer growth by repressing c-Fos-mediated lipid and redox dyshomeostasis.

doi: 10.1038/s12276-025-01430-3

Figure Lengend Snippet: Fig. 6 NR4A1 competitively inhibits c-Fos binding to targeted genes in BC cells. a Genome-wide profiles of c-Fos in NR4A1-knockout and control MCF7 cells. b Heat maps of c-Fos ChIP–seq signals sorted on the basis of increased c-Fos peaks between NR4A1-knockout and control MCF7 cells. c Genomic annotations of the increased c-Fos peaks in NR4A1-knockout cells by chromosome location. d GO analysis and KEGG analysis of NR4A1-competitive c-Fos occupied genes. e Motif sequences (left) and matched transcription factors (middle) with corresponding P values (right) from de novo motif analysis of NR4A1-competitive c-Fos peaks. f c-Fos ChIP–seq tracks at PRDX6 gene locus. g RT-qPCR analysis of PRDX6 mRNA levels in NR4A1-knockout and control cells. h Immunoblotting analysis of PRDX6 in BC cells with or without NR4A1. i Schematic diagram of PRDX6 promoter showing c-Fos and NR4A1 binding motifs in the regulator region. pGL3-NBREwt and pGL3-NBREdel stand for the PRDX6 promoter region with NBRE-like elements or NBRE-like elements deleted sequences, which were cloned upstream of the firefly luciferase gene in the pGL3-basic vector. j ChIP–qPCR analysis of c-Fos and NR4A1 enrichment around the c-Fos motif and NBRE-like elements on PRDX6 promoter in NR4A1 knockout and control MCF7 cells. k PRDX6 promoter constructs were co-transfected with NR4A1, c-Fos or empty vector (EV) to detect luciferase activity in HEK293T cells. pRL-TK was transfected for normalization, and luciferase activity was measured by using a dual luciferase reporter assay system. Unpaired Student’s t-tests were used in g, j and k, **P < 0.01, ***P < 0.001, NS nonsignificant.

Article Snippet: The sections were then exposed to antigen and incubated with a specific primary antibody against NR4A1 (Proteintech, cat. no. 12235-1-AP; 1:100 dilution), c-Fos (Abcam, cat. no. ab208942; 1:200 dilution) or PRDX6 (Abcam, cat. no. ab133348; 1:100 dilution) at 4 °C overnight, followed by incubating with the corresponding secondary antibodies at 37 °C for 1 h. Representative images were taken using an Olympus light microscope.

Techniques: Binding Assay, Genome Wide, Knock-Out, Control, ChIP-sequencing, Quantitative RT-PCR, Western Blot, Clone Assay, Luciferase, Plasmid Preparation, ChIP-qPCR, Construct, Transfection, Activity Assay, Reporter Assay

Journal: Experimental & molecular medicine

Article Title: NR4A1 suppresses breast cancer growth by repressing c-Fos-mediated lipid and redox dyshomeostasis.

doi: 10.1038/s12276-025-01430-3

Figure Lengend Snippet: Fig. 7 NR4A1 agonist represses the transcriptional activity of c-Fos. a Immunoblotting analysis of NR4A1 in MCF7 cells treated by different concentrations of Csn-B or vehicle. b Cell proliferation assay was performed by CCK-8 assay in MCF7 or T47D cells treated by different concentrations of Csn-B or vehicle. c Comparison of cell growth between Csn-B (10 μM) and vehicle treatment in NR4A1-knockout MCF7 cells or T47D cells. d–f, Csn-B inhibited BC growth in xenografts. Female athymic nude mice bearing wild-type MCF7 tumor were treated daily with vehicle or Csn-B. Tumor images (d), growth curves (e) and tumor weight (f) were obtained at the end of treatment. n = 10 per group. g Representative IHC staining of Ki67 and the statistical analysis of Ki67-positive percentages in tumors d. Scale bar, 100 μm. h Co-IP experiments to detect interactions between NR4A1 and c-Fos in MCF7 cells treated by 10 μM Csn-B or vehicle for 24 h. i ChIP assays of the c-Fos enrichment on PRDX6 promoter in MCF7 cells treated by 10 μM Csn-B or vehicle for 24 h. j, k RT-qPCR (j) and immunoblotting analysis (k) of PRDX6 in MCF7 or T47D cells treated by 10 μM Csn-B or vehicle for 24 h. l Comparison of PRDX6 mRNA levels in NR4A1-knockout and parental MCF7 cells treated by 10 μM Csn-B or vehicle for 24 h. m Cell proliferation assay was performed by CCK-8 assay in ectopic c-Fos- or EV- overexpressed MCF7 cells treated by 10 μM Csn-B or vehicle. Unpaired Student’s t-tests were used in f, g, i, j and l, and one-way ANOVA was used in b, c, e and m, *P < 0.05, **P < 0.01, ***P < 0.001, NS nonsignificant.

Article Snippet: The sections were then exposed to antigen and incubated with a specific primary antibody against NR4A1 (Proteintech, cat. no. 12235-1-AP; 1:100 dilution), c-Fos (Abcam, cat. no. ab208942; 1:200 dilution) or PRDX6 (Abcam, cat. no. ab133348; 1:100 dilution) at 4 °C overnight, followed by incubating with the corresponding secondary antibodies at 37 °C for 1 h. Representative images were taken using an Olympus light microscope.

Techniques: Activity Assay, Western Blot, Proliferation Assay, CCK-8 Assay, Comparison, Knock-Out, Immunohistochemistry, Co-Immunoprecipitation Assay, Quantitative RT-PCR

Journal: Experimental & molecular medicine

Article Title: NR4A1 suppresses breast cancer growth by repressing c-Fos-mediated lipid and redox dyshomeostasis.

doi: 10.1038/s12276-025-01430-3

Figure Lengend Snippet: Fig. 8 The impact of NR4A1–c-Fos–PRDX6 axis on BC prognosis. a Representative IHC staining of NR4A1, c-Fos and PRDX6 in cohort 2 TMA. Scale bars, 200 μm. b Pearson correlation analysis between NR4A1, c-Fos and PRDX6 protein expression based on IRS in cohort 2 TMA. R represents the Pearson correlation coefficient. c Kaplan–Meier survival plots of patients with BC in cohort 2 TMA based on c-Fos, or PRDX6 expression. d Kaplan–Meier survival plots of patients with BC in cohort 2 TMA based on the protein levels of NR4A1 co-expressed with PRDX6, or c-Fos co-expressed with PRDX6. e Kaplan–Meier survival plots of patients with BC in cohort 2 TMA based on the protein levels of NR4A1 co- expressed with c-Fos, or NR4A1 co-expressed with c-Fos and PRDX6. Log-rank tests were used in c–e. f Schematic diagram of the proposed mechanism.

Article Snippet: The sections were then exposed to antigen and incubated with a specific primary antibody against NR4A1 (Proteintech, cat. no. 12235-1-AP; 1:100 dilution), c-Fos (Abcam, cat. no. ab208942; 1:200 dilution) or PRDX6 (Abcam, cat. no. ab133348; 1:100 dilution) at 4 °C overnight, followed by incubating with the corresponding secondary antibodies at 37 °C for 1 h. Representative images were taken using an Olympus light microscope.

Techniques: Immunohistochemistry, Expressing